reverse primer nls mcherry noti r (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
reverse primer nls mcherry noti r
Reverse Primer Nls Mcherry Noti R, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5719 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer+nls+mcherry+noti+r/NotI/pmc11077057-56-50-72
Average 99 stars, based on 5719 article reviews
Reverse Primer Nls Mcherry Noti R, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5719 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer+nls+mcherry+noti+r/NotI/pmc11077057-56-50-72
Average 99 stars, based on 5719 article reviews
reverse primer nls mcherry noti r - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Identifying human pre-mRNA cleavage and polyadenylation factors by genome-wide CRISPR screens using a dual fluorescence readthrough reporter Article Snippet: First, a 540 bp IRES fragment from plasmid pIGCN21 ( ) (from the laboratory of Dr N. Copeland) was PCR amplified using the forward primer IRES.E.F1 (5′-ATA GAATTC ACGTTACTGGCCGAAGCCGCT-3′, EcoRI site underlined) and reverse primer IRES.B.R1 (5′- ATA GGATCC TTTTTCAAAGGAAAACCACGT-3′, BamHI site underlined), digested with EcoRI (NEB, catalogue number R0101S) and BamHI (NEB, catalogue number R0136S) and ligated to the EcoRI/BamHI-digested plasmid pAcGFP1-N3 (Clontech Laboratories Inc., catalogue number 632484), to generate a pIRES-GFP1 vector. .. Second, a 760 bp fragment containing mCherry (714 bp)-NLS (nuclear localization signal, 21 bp) was PCR amplified from the pLentiGuide mCherry-NLS-P2A-puro plasmid ( ) (obtained from Dr. Daniel Durocher, The Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Canada) using the forward primer mCherry.NLS.BamHI.F: (GATA GGATCC GCCACCATGGTGAGCAAGGGCGAG, BamHI site underlined) and Amplification:Article Title: Identifying human pre-mRNA cleavage and polyadenylation factors by genome-wide CRISPR screens using a dual fluorescence readthrough reporter Article Snippet: First, a 540 bp IRES fragment from plasmid pIGCN21 ( ) (from the laboratory of Dr N. Copeland) was PCR amplified using the forward primer IRES.E.F1 (5′-ATA GAATTC ACGTTACTGGCCGAAGCCGCT-3′, EcoRI site underlined) and reverse primer IRES.B.R1 (5′- ATA GGATCC TTTTTCAAAGGAAAACCACGT-3′, BamHI site underlined), digested with EcoRI (NEB, catalogue number R0101S) and BamHI (NEB, catalogue number R0136S) and ligated to the EcoRI/BamHI-digested plasmid pAcGFP1-N3 (Clontech Laboratories Inc., catalogue number 632484), to generate a pIRES-GFP1 vector. .. Second, a 760 bp fragment containing mCherry (714 bp)-NLS (nuclear localization signal, 21 bp) was PCR amplified from the pLentiGuide mCherry-NLS-P2A-puro plasmid ( ) (obtained from Dr. Daniel Durocher, The Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Canada) using the forward primer mCherry.NLS.BamHI.F: (GATA GGATCC GCCACCATGGTGAGCAAGGGCGAG, BamHI site underlined) and Plasmid Preparation:Article Title: Identifying human pre-mRNA cleavage and polyadenylation factors by genome-wide CRISPR screens using a dual fluorescence readthrough reporter Article Snippet: First, a 540 bp IRES fragment from plasmid pIGCN21 ( ) (from the laboratory of Dr N. Copeland) was PCR amplified using the forward primer IRES.E.F1 (5′-ATA GAATTC ACGTTACTGGCCGAAGCCGCT-3′, EcoRI site underlined) and reverse primer IRES.B.R1 (5′- ATA GGATCC TTTTTCAAAGGAAAACCACGT-3′, BamHI site underlined), digested with EcoRI (NEB, catalogue number R0101S) and BamHI (NEB, catalogue number R0136S) and ligated to the EcoRI/BamHI-digested plasmid pAcGFP1-N3 (Clontech Laboratories Inc., catalogue number 632484), to generate a pIRES-GFP1 vector. .. Second, a 760 bp fragment containing mCherry (714 bp)-NLS (nuclear localization signal, 21 bp) was PCR amplified from the pLentiGuide mCherry-NLS-P2A-puro plasmid ( ) (obtained from Dr. Daniel Durocher, The Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Canada) using the forward primer mCherry.NLS.BamHI.F: (GATA GGATCC GCCACCATGGTGAGCAAGGGCGAG, BamHI site underlined) and |